A|A|A
kinderneurologie

 

 

 

 

 



Ziektenbeelden

Vraag om informatie

Gastenboek

Van A tot en met Z

Praktische links

Contact met ouders

Neurologische woordenlijst

DNA

 

Wat is het DNA?
Het DNA is de naam voor het zogenaamde boekje wat in al onze lichaamscellen aanwezig is en waarin precies staat beschreven hoe ons lichaam opgebouwd is en hoe verschillende onderdelen van ons lichaam moeten werken. Het is dus heel belangrijk voor het lichaam. Het DNA wordt ook wel ons erfelijk materiaal genoemd.

 

Waar zit het DNA in ons lichaam?
Het DNA zit in elke lichaamscel van het lichaam. Het lichaam bestaat uit heel veel lichaamscellen. Elke lichaamscel heeft allerlei verschillende onderdelen zoals een kern, energiefabriekjes (mitochondriën), eiwitfabriekjes (ribosomen) en opruimfabriekjes (peroxisomen en lysosomen). Het meeste DNA zit in de kern van de cel. Maar er zit ook een heel klein beetje DNA in de energiefabriekjes, de mitochondriën.
Het DNA in de kern van de cel wordt kernDNA genoemd en het DNA in de energiefabriekjes mitochondrieel DNA.

 

Wat doet het DNA?
Het DNA is als het ware het kookboek waarin precies staat hoe bij een baby het lichaam moet worden aangelegd en hoe het lichaam moet functioneren. In het DNA ligt dus vast welke kleur ogen een baby gaat krijgen, hoe groot het kind zal worden, hoe de hersenen worden opgebouwd, hoe sterk de spieren worden en hoe de hersenen later werken.
Het DNA wordt daarom voortdurend gelezen en aan de hand van het DNA worden allerlei eiwitten aangemaakt die er voor zorgen dat bepaalde functies door de cellen worden uitgevoerd.

 

Waaruit bestaat het DNA?
Het DNA is eigenlijk een hele lange zin die bestaat uit allemaal letters achter elkaar. Het DNA kent maar vier letters: de A, de C, de G en de T. Met deze letters wordt onze lichaamsboek helemaal geschreven. Het zijn dus eigenlijk hele rare woorden en zinnen bijvoorbeeld ACCCAGTTCCCCTTTCCGGAAGGCCTT en dat kan dus voldoende zijn voor een cel om te weten dat een bepaald eiwit moet worden aangemaakt.

 

Wat is een gen?
Een gen is een stuk DNA waarin de informatie staat voor de aanmaak van één eiwit. Dus alle letters die nodig zijn om één eiwit te maken. Vaak zijn dat al heel veel letters bij elkaar. Hoe groter het eiwit, hoe meer letters in het gen zullen zitten om dit grote eiwit aan te maken. Een gen is dus te vergelijken met een recept in een kookboek.

Exomen en intronen
Een gen is weer onderverdeeld in exomen en in intronen. Wanneer je een gen vergelijkt met een recept, dan kun je de exomen vergelijken met de tekst waarin staat hoe je dat recept moet maken. De intronen kun je vergelijk met de plaatjes bij een recept die je helpen om te begrijpen wat er in de tekst staat.

 

Wat zijn chromosomen?
Het DNA bestaat uit een lange sliert met letters. Het zou niet handig zijn om in elke cel van die lange slierten te hebben rondzweven. Daarom worden deze lange slierten helemaal opgerold en opgevouwen zodat ze compact zijn. Een opgerold en opgevouwen stuk DNA wordt een chromosoom genoemd.
Al het DNA van een lichaamscel past niet in één chromosoom, maar wordt verpakt in meerdere chromosomen. Normaal heeft een mens in elke cel 46 chromosomen zitten. In elke cel zitten dus 46 kookboeken.

Chromosomen dubbel
Van elk chromosoom (kookboek) zitten er in de cel 2 exemplaren. Mocht er eentje kwijt raken dan heeft het lichaam nog een andere chromosoom (kookboek). Elk chromosoom (kookboek) heeft een nummer gekregen, zoals chromosoom 1, chromosoom 2 tot en met chromosoom 22. Het grootste chromosoom (kookboek) heeft nummer 1 gekregen, het kleinste chromosoom (kookboek) nummer 22. Alle chromosomen zijn dus dubbel. In elke cel zit dus twee keer chromosoom 1, twee keer chromosoom 2 enzovoort.

Geslachtschromosomen
De laatste 2 chromosomen van de 46 hebben een andere naam gekregen. Deze hebben de naam X of Y gekregen. Het zijn de zogenaamde geslachtschromosomen. Op deze chromosomen staat namelijk de informatie of een baby een jongen of een meisje zal worden. Zodra een baby een Y –chromosoom krijgt wordt het een jongen, krijgt een baby geen Y-chromosoom dan wordt het een meisje. Elke cel heeft 2 geslachtschromosomen. Een meisje heeft 2 X-chromosomen, een jongen heeft een X en een Y chromosoom.

Informatie door elkaar
Het rare aan de chromosomen is, dat niet alle informatie netjes bij elkaar staat per chromosoom, maar dat de informatie voor bijvoorbeeld de aanleg van de hersenen verspreid is over verschillende chromosomen. Er is dus niet een kookboek waarin staat beschreven hoe je soep maakt en een ander kookboek waarin alles staat over het maken van groente. Als je soep wilt maken dan heb je alle kookboeken nodig en moet je uit kookboek 1 iets halen, uit kookboek 3 , 4 en 6 en uit kookboek 22. Informatie over aanleg van het oog ligt dus bijvoorbeeld op chromosoom 1, 7,12, 18 en 22.

P, Q, cijfers
Om precies aan te geven waar op het chromosoom bepaalde informatie ligt, worden vaak de letters p en q en cijfers achter het chromosoom gezet, zodat het voor artsen meteen duidelijk is over welk stukje van het chromosoom we praten. Zo wordt dan bijvoorbeeld gesproken over 22q11 of 16p11.2. Artsen weten dan precies welke stukje van chromosoom 22 wordt bedoeld of welk stukje van chromosoom 16.
Elk chromosoom heeft namelijk een insnoering, waardoor het chromosoom verdeeld wordt in twee helften, de ene helft wordt p genoemd, de andere helft q. Daarna krijgen stukjes van het chromosoom een nummer, de hoofdstukken in het kookboek zeg maar. Stukjes dichtbij de insnoering krijgen nummer 1 en stukjes verder weg een hoger nummer. Dit allemaal bedoeld zodat dokters en wetenschappers met elkaar kunnen praten waarop het chromosoom nu een probleem aanwezig is.

 

Hoe komen mensen aan hun DNA?
Het DNA krijg je van je vader en van je moeder. De ene helft van het DNA komt van de vader en de andere helft van het DNA komt van de moeder. De unieke combinatie van twee verschillende stukken DNA, maakt een uniek kind. De vader geeft het DNA door via de zaadcel, de moeder via de eicel.
Het kind krijgt het ene chromosoom 1 van de vader en het andere chromosoom 1 van de moeder en dat geldt zo voor alle chromosomen. Een jongen krijgt een Y-chromosoom van zijn vader en een X-chromosoom van zijn moeder. Een meisje krijgt van de vader een X-chromosoom en ook van de moeder een X-chromosoom.

 

Hoe ontstaan fouten in het DNA?
Delen van cellen
In het prille begin heb je dus een eicel en een zaadcel die samensmelten tot de allereerste cel van de baby. Deze cel bevat dus DNA wat opgerold is tot chromosomen. Uit die ene cel ontstaan twee nieuwe cellen. Deze cellen moeten elk ook 46 chromosomen krijgen. Daarom moet het DNA helemaal worden overgeschreven zodat er een dubbele hoeveelheid DNA aanwezig is. Elke cel krijgt dan de helft van dit DNA. Dat overschrijven van het DNA is een heel werk, waarin foutjes worden gemaakt. Vaak worden deze foutjes weer hersteld, maar soms niet allemaal. Dan blijft er een foutje bestaan in het DNA. De twee nieuwe lichaamscellen worden er vier, vier worden er acht en acht worden er 16 enzovoort. Telkens moet het DNA worden overgeschreven en telkens bestaat er de kans dat er een foutje in het DNA ontstaat.

Niet elk foutje in het DNA geeft meteen problemen. Wanneer bijvoorbeeld in het woord KOEK, de E wegvalt staat er KOK. Misschien lees je dit hoofdstuk dan nog wel wanneer je iets wilt gaan koken en heeft het foutje niet hele grote gevolgen. Wanneer echter de eerste K wegvalt staat er OEK, het is niet waarschijnlijk dat dit hoofdstuk dan nog gelezen wordt.

Foutje bij maken eicellen en zaadcellen
Een andere manier waardoor een kind te veel of te weinig chromosomen kan hebben, is door een foutje bij de aanmaak van een eicel of een zaadcel. Een eicel of een zaadcel hoort de helft van alle chromosomen te krijgen, dus één chromosoom 1, één chromosoom 2 etc. Soms gaat dit mis en krijgt de eicel of de zaadcel twee chromosomen 1 of geen chromosoom 1. Wanneer er dan een kind ontstaat uit deze eicel of zaadcel in combinatie met een normale zaadcel of eicel dan krijgt dit kind drie keer chromosoom 1 of heeft het maar een keer chromosoom 1. Beide situaties zorgen voor problemen.

Virussen
Virussen kunnen veranderingen aanbrengen in het DNA waardoor er fouten in het DNA ontstaan.

Straling
Ook verschillende soorten straling kunnen zorgen voor het ontstaan van foutjes in het DNA. Zonnestralen kunnen in de huid zorgen voor veranderingen in het DNA, maar ook een behandeling met bestraling of straling die vrijkomt bij een ramp met een kernreactor zorgt voor foutjes in het DNA.

Veroudering
Wanneer een cel ouder wordt, dan ontstaan ook vaak foutjes in het DNA. Daarom hebben oudere mensen vaak meer fouten in hun DNA dan jongere mensen.

Niet bekend
Verder zijn ook nog niet alle oorzaken bekend waardoor veranderingen in het DNA kunnen ontstaan.

 

Hoe kan het DNA onderzocht worden?

Bloed
Uit een buisje bloed kunnen witte bloedcellen gehaald worden. In deze witte bloedcellen zit DNA wat er met speciale laboratoriumtechnieken uitgehaald kan worden. Dit DNA kan vervolgens onderzocht worden. Daarvoor bestaan verschillende technieken.

Ander materiaal
Ook in andere materiaal kunnen cellen zitten waar DNA uit gehaald kan worden. Bijvoorbeeld uit wangslijmvliescellen, uit huidcellen, uit spiercellen of uit vruchtwater verkregen met een vruchtwaterpunctie of uit vlokken verkregen bij een vlokkentest. Ook op deze manier kan het DNA worden onderzocht.

 

Welke technieken bestaan er om DNA te onderzoeken?
Chromosomenonderzoek
De chromosomen kunnen bekeken worden door een speciale microscoop. Dit wordt chromosomenonderzoek genoemd. Op die manier kan gekeken worden of een kind 46 chromosomen in een cel heeft of misschien 47 of 45 en kan ook gekeken welk chromosoom dan teveel of te weinig aanwezig is. Wanneer een groot stuk van een chromosoom mist is dit ook zichtbaar te maken met chromosomen onderzoek.
We kunnen de vergelijking maken met de kast met daarin de 46 kookboeken (die chromosomen voorstellen) met deze techniek kun je zien of er een boek te veel of te weinig aanwezig is in de kast, je kunt ook nog wel zien of een boek veel dikker of dunner is dan normaal, maar je kunt niet zien of er een hoofdstuk, bladzijde of regel mist in het boek.

MLPA
MLPA is een techniek waarbij gekeken wordt op specifieke stukjes op verschillende chromosomen wel aanwezig zijn of niet en of ze in normale hoeveelheid aanwezig zijn. Dit is al een fijner techniek dan het chromosomen onderzoek, maar een minder verfijnde techniek dan het chromosomen onderzoek. Wanneer we het weer vergelijken met de kast met kookboeken, kun je hiermee ook zien of er 46 boeken aanwezig zijn in de kast, maar kun je ook zien of alle hoofdstukken in de boeken wel aanwezig zijn. Je kunt echter niet zien of er een bladzijde mist uit een boek of een regel op een bladzijde.

Array
De Array is een techniek waarbij ook gekeken kan worden of er stukjes van chromosomen te veel aanwezig zijn of dat er stukjes van een chromosoom missen. Deze techniek is al weer gevoeliger dan het chromosomenonderzoek. Toch wordt pas ontdekt dat er een stukje chromosoom mist of te veel aanwezig is, wanneer dit stukje uit bijvoorbeeld 25.000 letters bestaat. Wanneer er een stukje erfelijk materiaal mist wat uit 24.000 letters bestaat, dan kan de Array dit foutje niet opsporen. Terwijl zo’n foutje wel gevolgen kan hebben voor de ontwikkeling van een kind.
De vergelijking met de boekenkast, de Array kan laten zien of er 46 boeken in de kast aanwezig zijn en ook zien of er hoofdstukken of bladzijden missen. De array kan niet zien of er een regel uit een bladzijde mist of een woord in deze regel.

Gen-onderzoek
Wanneer er gedacht wordt aan een bepaalde aandoening die veroorzaakt wordt door een specifiek foutje in het erfelijk materiaal op een specifieke plek in een bepaald gen, dan kan het DNA op die specifieke plek lettertje voor lettertje bekeken worden. Zo kan gekeken worden of er een fout aanwezig is op die specifieke plek. Dit is dus een hele gevoelige test, maar er wordt dus alleen maar gekeken naar een heel specifiek klein stukje van het DNA. Foutjes op een andere plek worden niet met deze techniek opgespoord. Wanneer je dit weer wilt vergelijken met het kookboek, dan vraag je iemand of die wil kijken of er nog fouten in je kookboek staan in het recept voor uiensoep. Die fouten haalt iemand eruit, maar of er dan nog een fout staat in het recept voor champignonsoep weet je niet.

Whole exome sequencing (WES)
Een van de nieuwste technieken is exome sequencing. Bij deze techniek kan het DNA van de exomen lettertje voor lettertje onderzocht worden. Op deze manier kunnen alle chromosomen in een keer bekeken worden en kan gekeken worden of er ergens een foutje zit in het erfelijk materiaal. Dit is wel heel veel werk. Weer de vergelijking met het kookboek, iemand kijkt nu alle recepten na op foutjes en kan ook al deze foutjes eruit halen. Foutjes in de begeleidende plaatjes of aanwijzingen in het kookboek kunnen er op deze manier niet uitgehaald worden.
Geleidelijk aan komt deze techniek nu beschikbaar in Nederland.

Whole genome sequencing
De allernieuwste techniek is whole genome sequencing. Een gen bestaat uit exomen en intronen, de exomen zijn de tekst van het recept, de intronen de plaatsjes en aanwijzingen. Een verkeerd plaatje bij een recept kan maken dat je het recept niet op de goede manier uitvoert. Een foutje in een intron kan ook zorgen voor problemen. Bij whole exome sequencing wordt alleen gekeken naar de exomen, bij whole genome sequencing wordt gekeken naar de exomen en naar de intronen. Deze techniek is nu nog niet beschikbaar in Nederland, maar de verwachting is dat dit over enkele jaren wel het geval zal zijn.

Nu kunne dus alle kookboeken helemaal worden na gekeken en kan gekeken worden of er een kookboek mist of te veel is, maar wordt er ook gezien of er een woord of een letter te veel of te weinig in staat en of alle plaatsjes wel kloppen.

 

 

Laatst bijgewerkt: 1 maart 2014

 

Auteur: JH Schieving

 

 

 

 

 

 

Hier is ruimte voor
Uw verhaal

Heeft uw kind nog andere symptomen, laat het ons weten.